b2opdmillian3a b2opdmillian3a

01-12-2016
English

contestada

Prefix that means outside

Respuesta :

01-12-2016

"Ex" or "exo" is a prefix that means "outside."

Answer Link

06-12-2016

A prefix is part of a word, for example, if you have the word "enter" you could add the prefix "re" to get "re-enter". Other examples of prefixes are, semi, pre, sub, ect.

Answer Link

Otras preguntas

What would happen if you did not have the stapedius and tensor tympani muscles? A. The ear canal would stay permanently closed. B. The ear canal would stay perm

A car rental company at the local airport estimates they sell liability insurance to 45% of their customers. If they rent 3,000 cars next month, how many renter

At time x = 0, water begins to drip steadily out of a water tank. After 1 hour, there are 5.6 gallons of water in the tank. After 7 hours, 3.2 gallons remain

Tyrel is testing whether exposure to political news causes people to be more opinionated. For each participant, Tyrel flips a coin and places all the heads in o

b. Interpret the Rsquared value. Does the multiple regression equation help us predict the total golf score much better than we could without knowing that equa

What separates rabbits/primate from the crocodiles on this cladogram?

A new cellular phone tower services all phones within a 17 mile radius. Doreen lives 15 miles and and 8 miles south of the tower. Is she within the area service

Together, Victor and Tami Vargas earn $33,280 per year. Tami earns $4,160 more per year than Victor earns. How much do Victor and Tami each earn per year?

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

2 After studying all night, Charles walked around like the living dead. The author uses an oxymoron to describe Charles' performance on his test. © The author u